---
name: "trf"
section: "1"
platform: "linux"
package: "trf"
version: "4.09.1-6"
release: "Debian 13 (Trixie)"
platforms: ["linux"]
url: "https://new.carta.tech/trf"
---

# trf(1)

locate and display tandem repeats in DNA sequences

## NAME

trf - locate and display tandem repeats in DNA sequences

## SYNOPSIS

**trf** (File\|Match\|Mismatch\|Delta\|PM\|PI\|Minscore\|MaxPeriod) \[options\]

## OPTIONS

Where: (all weights, penalties, and scores are positive)

- File

  sequences input file

- Match

  matching weight

- Mismatch

  mismatching penalty

- Delta

  indel penalty

- PM

  match probability (whole number)

- PI

  indel probability (whole number)

- Minscore

  minimum alignment score to report

- MaxPeriod

  maximum period size to report

### \[options\] = one or more of the following:

- **-m**

  masked sequence file

- **-f**

  flanking sequence

- **-d**

  data file

- **-h**

  suppress html output

- **-r**

  no redundancy elimination

- **-l** \<n\>

  maximum TR length expected (in millions) (eg, **-l** 3 or **-l**=*3* for 3 million) Human genome HG38 would need **-l** 6

- **-ngs**

  more compact .dat output on multisequence files, returns 0 on success. Output is printed to the screen, not a file. You may pipe input in with this option using - for file name. Short 50 flanks are appended to .dat output.

## SEE ALSO

See more information on the TRF Unix Help web page: https://tandem.bu.edu/trf/trf.unix.help.html

## NOTE

Note the sequence file should be in FASTA format:

\>Name of sequence aggaaacctgccatggcctcctggtgagctgtcctcatccactgctcgctgcctctccag atactctgacccatggatcccctgggtgcagccaagccacaatggccatggcgccgctgt actcccacccgccccaccctcctgatcctgctatggacatggcctttccacatccctgtg

## AUTHOR

Copyright © 1999-2020 Gary Benson

This manpage was written by Andreas Tille for the Debian distribution and can be used for any other usage of the program.