NAME
trf - locate and display tandem repeats in DNA sequences
SYNOPSIS
trf (File|Match|Mismatch|Delta|PM|PI|Minscore|MaxPeriod) [options]
OPTIONS
Where: (all weights, penalties, and scores are positive)
- File
-
sequences input file
- Match
-
matching weight
- Mismatch
-
mismatching penalty
- Delta
-
indel penalty
- PM
-
match probability (whole number)
- PI
-
indel probability (whole number)
- Minscore
-
minimum alignment score to report
- MaxPeriod
-
maximum period size to report
[options] = one or more of the following:
- -m
-
masked sequence file
- -f
-
flanking sequence
- -d
-
data file
- -h
-
suppress html output
- -r
-
no redundancy elimination
- -l <n>
-
maximum TR length expected (in millions) (eg, -l 3 or -l=3 for 3 million) Human genome HG38 would need -l 6
- -ngs
-
more compact .dat output on multisequence files, returns 0 on success. Output is printed to the screen, not a file. You may pipe input in with this option using - for file name. Short 50 flanks are appended to .dat output.
SEE ALSO
See more information on the TRF Unix Help web page: https://tandem.bu.edu/trf/trf.unix.help.html
NOTE
Note the sequence file should be in FASTA format:
>Name of sequence aggaaacctgccatggcctcctggtgagctgtcctcatccactgctcgctgcctctccag atactctgacccatggatcccctgggtgcagccaagccacaatggccatggcgccgctgt actcccacccgccccaccctcctgatcctgctatggacatggcctttccacatccctgtg
AUTHOR
Copyright © 1999-2020 Gary Benson
This manpage was written by Andreas Tille for the Debian distribution and can be used for any other usage of the program.