---
name: "tqs"
section: "1"
platform: "linux"
package: "ssake"
version: "4.0.1-2"
release: "Debian 13 (Trixie)"
platforms: ["linux"]
url: "https://new.carta.tech/tqs"
---

# tqs(1)

Trim Quality Solexa-Illumina Sequences

## NAME

tqs - Trim Quality Solexa-Illumina Sequences

## SYNOPSIS

Quality trim solexa-Illumina sequence reads using user-defined thresholds.

## OPTIONS

- \-h, --help

  show this help message and exit

- \-f SEQFILE, --sequence file=SEQFILE

  Illumina sequence file - Output format from the 1G Genome Analyzer (\_seq.txt):\
       7       1       255     669\
       AACCCCCACTCCTACAACGCCATCATTCCCCTCGAC

- \-q QUALFILE, --qual file=QUALFILE

  A prb file containing all the Illumina intensities, as outputted by the 1G Genome Analyzer (\_prb.txt)

- \-l MER, --length=MER

  Length of sequence reads (i.e. Number of sequencing cycles, default=36)

- \-t THRESHOLD, --threshold=THRESHOLD

  Base intensity threshold value (-40 to 40, default=5)

- \-d DIFF, --difference=DIFF

  Base intensity difference between top intensity and second best (1 to 80, default=5)

- \-c CONSEC, --consec=CONSEC

  Minimum number of consecutive bases passing threshold values (default=20)

- \-v, --verbose

  Runs in Verbose mode.

## SEE ALSO

/usr/share/doc/ssake/TQS.readme

## AUTHORS

This manual page was written by Andreas Tille \<tille@debian.org\> for the **Debian** system (but may be used by others).  Permission is granted to copy, distribute and/or modify this document under the terms of the GNU General Public License, Version 2 any later version published by the Free Software Foundation.

On Debian systems, the complete text of the GNU General Public License can be found in /usr/share/common-licenses/GPL.