---
name: "gt-fingerprint"
section: "1"
platform: "linux"
package: "genometools"
version: "1.6.5+ds-2.2"
release: "Debian 13 (Trixie)"
platforms: ["linux"]
url: "https://new.carta.tech/gt-fingerprint"
---

# gt-fingerprint(1)

Compute MD5 fingerprints for each sequence given in a set of sequence files.

## NAME

gt-fingerprint - Compute MD5 fingerprints for each sequence given in a set of sequence files.

## SYNOPSIS

**gt fingerprint** \[option ...\] sequence\_file \[...\]

## DESCRIPTION

- **-check** \[*filename*\]

  compare all fingerprints contained in the given checklist file with checksums in given sequence\_files(s). The comparison is successful, if all fingerprints given in checkfile can be found in the sequence\_file(s) in the exact same quantity and vice versa. (default: undefined)

- **-duplicates** \[*yes\|no*\]

  show duplicate fingerprints from given sequence\_file(s). (default: no)

- **-extract** \[*string*\]

  extract the sequence(s) with the given fingerprint from sequence file(s) and show them on stdout. (default: undefined)

- **-width** \[*value*\]

  set output width for FASTA sequence printing (0 disables formatting) (default: 0)

- **-o** \[*filename*\]

  redirect output to specified file (default: undefined)

- **-gzip** \[*yes\|no*\]

  write gzip compressed output file (default: no)

- **-bzip2** \[*yes\|no*\]

  write bzip2 compressed output file (default: no)

- **-force** \[*yes\|no*\]

  force writing to output file (default: no)

- **-help**

  display help and exit

- **-version**

  display version information and exit

If neither option *-check* nor option *-duplicates* is used, the fingerprints for all sequences are shown on stdout.

Fingerprint of a sequence is case insensitive. Thus MD5 fingerprint of two identical sequences will be the same even if one is soft-masked.

## EXAMPLES

Compute (unified) list of fingerprints:

```
$ gt fingerprint U89959_ests.fas | sort | uniq > U89959_ests.checklist_uniq
```

Compare fingerprints:

```
$ gt fingerprint -check U89959_ests.checklist_uniq U89959_ests.fas
950b7715ab6cc030a8c810a0dba2dd33 only in sequence_file(s)
```

Make sure a sequence file contains no duplicates (not the case here):

```
$ gt fingerprint -duplicates U89959_ests.fas
950b7715ab6cc030a8c810a0dba2dd33        2
gt fingerprint: error: duplicates found: 1 out of 200 (0.500%)
```

Extract sequence with given fingerprint:

```
$ gt fingerprint -extract 6d3b4b9db4531cda588528f2c69c0a57 U89959_ests.fas
>SQ;8720010
TTTTTTTTTTTTTTTTTCCTGACAAAACCCCAAGACTCAATTTAATCAATCCTCAAATTTACATGATAC
CAACGTAATGGGAGCTTAAAAATA
```

## RETURN VALUES

• 0 everything went fine (*-check*: the comparison was successful; *-duplicates*: no duplicates found)

• 1 an error occurred (*-check*: the comparison was not successful; *-duplicates*: duplicates found)

## REPORTING BUGS

Report bugs to https://github.com/genometools/genometools/issues.