Bio::Seq::PrimedSeq(3pm)

NAME

Bio::Seq::PrimedSeq - A sequence and a pair of primers matching on it

SYNOPSIS

  use Bio::Seq;
  use Bio::Seq::PrimedSeq;
  my $template = Bio::Seq->new( -seq => 'AGCTTTTCATTCTGACTGCAAC' );
  my $left     = Bio::Seq->new( -seq => 'AGCT' );
  my $right    = Bio::Seq->new( -seq => 'GTTGC' );
  my $primedseq = Bio::Seq::PrimedSeq->new(
          -seq          => $template,  # sequence object
          -left_primer  => $left,      # sequence or primer object
          -right_primer => $right      # sequence or primer object
  );
  # Get the primers as Bio::SeqFeature::Primer objects
  my @primer_objects = $primedseq->get_primer();
  # Sequence object representing the PCR product, i.e. the section of the target
  # sequence contained between the primers (primers included)
  my $amplicon_seq = $primedseq->amplicon();
  print 'Got amplicon sequence: '.$amplicon_seq->seq."\n";
  # Amplicon should be: agctTTTCATTCTGACTgcaac

DESCRIPTION

This module was created to address the fact that a primer is more than a SeqFeature and that there is a need to represent the primer-sequence complex and the attributes that are associated with the complex.

A PrimedSeq object is initialized with a target sequence and two primers. The location of the primers on the target sequence is calculated if needed so that one can then get the PCR product, or amplicon sequence. From the PrimedSeq object you can also retrieve information about melting temperatures and what not on each of the primers and the amplicon. The Bio::Tools::Primer3 module uses PrimedSeq objects extensively.

Note that this module does not simulate PCR. It assumes that the primers will match in a single location on the target sequence and does not understand degenerate primers.

•

Providing primers as sequence objects

If the primers are specified as sequence objects, e.g. Bio::PrimarySeq or Bio::Seq, they are first converted to Bio::SeqFeature::Primer objects. Their location on the target sequence is then calculated and added to the Bio::SeqFeature::Primer objects, which you can retrieve using the get_primer() method.

•

Providing primers as primer objects

Because of the limitations of specifying primers as sequence objects, the recommended method is to provide Bio::SeqFeature::Primer objects. If you did not record the location of the primers in the primer object, it will be calculated.

Bio::Seq::PrimedSeq was initially started by Chad Matsalla, and later improved on by Rob Edwards.

RECIPES

1.

Run Primer3 to get PrimedSeq objects:

  use Bio::SeqIO;
  use Bio::Tools::Run::Primer3;
  # Read a target sequences from a FASTA file
  my $file = shift || die "Need a file to read";
  my $seqin = Bio::SeqIO->new(-file => $file);
  my $seq = $seqin->next_seq;
  # Use Primer3 to design some primers
  my $primer3 = Bio::Tools::Run::Primer3->new(-seq => $seq);
  my $results = $primer3->run; # default parameters
  # Write all the results in a Genbank file
  my $seqout = Bio::SeqIO->new(-file => ">primed_sequence.gbk", 
                               -format => 'genbank');
  while (my $primedseq = $results->next_primer) {
     $seqout->write_seq( $primedseq->annotated_seq );
  }

2.

Create a genbank file for a sequence and its cognate primers:

  use Bio::SeqIO;
  use Bio::Seq::PrimedSeq;
  # Read a FASTA file that contains the target sequence and its two primers
  my $file = shift || die "$0 <file>";
  my $seqin = Bio::SeqIO->new(-file => $file);
  my ($template, $leftprimer, $rightprimer) = 
        ($seqin->next_seq, $seqin->next_seq, $seqin->next_seq);
  # Set up a PrimedSeq object
  my $primedseq = Bio::Seq::PrimedSeq->new(-seq => $template, 
                                           -left_primer => $leftprimer,
                                           -right_primer => $rightprimer);
  # Write the sequences in an output Genbank file
  my $seqout = Bio::SeqIO->new(-file => ">primed_sequence.gbk",
                               -format => 'genbank');
  $seqout->write_seq($primedseq->annotated_sequence);

FEEDBACK

User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated.

  [email protected]                  - General discussion
  http://bioperl.org/wiki/Mailing_lists  - About the mailing lists

  https://github.com/bioperl/bioperl-live/issues

AUTHOR

Rob Edwards, [email protected]

Based on a module written by Chad Matsalla, [email protected]

APPENDIX

The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _

 Title   : new()
 Usage   : my $primedseq = Bio::SeqFeature::Primer->new( 
                            -seq => $sequence,
                            -left_primer => $left_primer,
                            -right_primer => $right_primer
           );
 Function: Construct a primed sequence.
 Returns : A Bio::Seq::PrimedSeq object
 Args    :  -seq => a Bio::Seq object (required)
            -left_primer => a Bio::SeqFeature::Primer or sequence object (required)
            -right_primer => a Bio::SeqFeature::Primer or sequence object (required)
           If you pass a sequence object to specify a primer, it will be used to
           construct a Bio::SeqFeature::Primer that you can retrieve with the
           L<get_primer> method.
           Many other parameters can be included including all of the output
           parameters from the primer3 program (see L<Bio::Tools::Primer3>). At
           the moment these parameters will simply be stored and do anything.

 Title   : get_primer();
 Usage   :  my @primers = $primedseq->get_primer();
              or
            my $primer = $primedseq->get_primer('-left_primer');
 Function: Get the primers associated with the PrimedSeq object.
 Returns : A Bio::SeqFeature::Primer object
 Args    : For the left primer, use: l, left, left_primer or -left_primer
           For the right primer, use: r, right, right_primer or -right_primer
           For both primers [default], use: b, both, both_primers or -both_primers

 Title   : annotated_sequence
 Usage   : my $annotated_sequence_object = $primedseq->annotate_sequence();
 Function: Get an annotated sequence object containing the left and right
           primers
 Returns : An annotated sequence object or 0 if not defined.
 Args    : 
 Note    : Use this method to return a sequence object that you can write
           out (e.g. in GenBank format). See the example above.

 Title   : amplicon
 Usage   : my $amplicon = $primedseq->amplicon();
 Function: Retrieve the amplicon as a sequence object. The amplicon sequnce is
           only the section of the target sequence between the primer matches
           (primers included).
 Returns : A Bio::Seq object. To get the sequence use $amplicon->seq
 Args    : None
 Note    :

 Title   : seq
 Usage   : my $seqobj = $primedseq->seq();
 Function: Retrieve the target sequence as a sequence object
 Returns : A seq object. To get the sequence use $seqobj->seq
 Args    : None
 Note    :

 Title   : _place_primers
 Usage   : $self->_place_primers();
 Function: An internal method to place the primers on the sequence and 
           set up the ranges of the sequences
 Returns : Nothing
 Args    : None
 Note    : Internal use only