Reference

Bio::PrimarySeq(3pm)

Bioperl lightweight sequence object

NAME

Bio::PrimarySeq - Bioperl lightweight sequence object

SYNOPSIS

  # Bio::SeqIO for file reading, Bio::DB::GenBank for
  # database reading
  use Bio::Seq;
  use Bio::SeqIO;
  use Bio::DB::GenBank;
  # make from memory
  $seqobj = Bio::PrimarySeq->new (
      -seq              => 'ATGGGGTGGGCGGTGGGTGGTTTG',
      -id               => 'GeneFragment-12',
      -accession_number => 'X78121',
      -alphabet         => 'dna',
      -is_circular      => 1,
  );
  print "Sequence ", $seqobj->id(), " with accession ",
    $seqobj->accession_number, "\n";
  # read from file
  $inputstream = Bio::SeqIO->new(
      -file   => "myseq.fa",
      -format => 'Fasta',
  );
  $seqobj = $inputstream->next_seq();
  print "Sequence ", $seqobj->id(), " and desc ", $seqobj->desc, "\n";
  # to get out parts of the sequence.
  print "Sequence ", $seqobj->id(), " with accession ",
    $seqobj->accession_number, " and desc ", $seqobj->desc, "\n";
  $string  = $seqobj->seq();
  $string2 = $seqobj->subseq(1,40);

DESCRIPTION

PrimarySeq is a lightweight sequence object, storing the sequence, its name, a computer-useful unique name, and other fundamental attributes. It does not contain sequence features or other information. To have a sequence with sequence features you should use the Seq object which uses this object.

Although new users will use Bio::PrimarySeq a lot, in general you will be using it from the Bio::Seq object. For more information on Bio::Seq see Bio::Seq. For interest you might like to know that Bio::Seq has-a Bio::PrimarySeq and forwards most of the function calls to do with sequence to it (the has-a relationship lets us get out of a otherwise nasty cyclical reference in Perl which would leak memory).

Sequence objects are defined by the Bio::PrimarySeqI interface, and this object is a pure Perl implementation of the interface. If that's gibberish to you, don't worry. The take home message is that this object is the bioperl default sequence object, but other people can use their own objects as sequences if they so wish. If you are interested in wrapping your own objects as compliant Bioperl sequence objects, then you should read the Bio::PrimarySeqI documentation

The documentation of this object is a merge of the Bio::PrimarySeq and Bio::PrimarySeqI documentation. This allows all the methods which you can call on sequence objects here.

FEEDBACK

Mailing Lists

User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated.

  [email protected]                  - General discussion
  http://bioperl.org/wiki/Mailing_lists  - About the mailing lists

Support

Please direct usage questions or support issues to the mailing list:

[email protected]

rather than to the module maintainer directly. Many experienced and reponsive experts will be able look at the problem and quickly address it. Please include a thorough description of the problem with code and data examples if at all possible.

Reporting Bugs

Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via the web:

  https://github.com/bioperl/bioperl-live/issues

AUTHOR - Ewan Birney

Email [email protected]

APPENDIX

The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _

new

 Title   : new
 Usage   : $seqobj = Bio::PrimarySeq->new( -seq => 'ATGGGGGTGGTGGTACCCT',
                                           -id  => 'human_id',
                                           -accession_number => 'AL000012',
                                           );
 Function: Returns a new primary seq object from
           basic constructors, being a string for the sequence
           and strings for id and accession_number.
           Note that you can provide an empty sequence string. However, in
           this case you MUST specify the type of sequence you wish to
           initialize by the parameter -alphabet. See alphabet() for possible
           values.
 Returns : a new Bio::PrimarySeq object
 Args    : -seq              => sequence string
           -ref_to_seq       => ... or reference to a sequence string
           -display_id       => display id of the sequence (locus name)
           -accession_number => accession number
           -primary_id       => primary id (Genbank id)
           -version          => version number
           -namespace        => the namespace for the accession
           -authority        => the authority for the namespace
           -description      => description text
           -desc             => alias for description
           -alphabet         => skip alphabet guess and set it to dna, rna or protein
           -id               => alias for display id
           -is_circular      => boolean to indicate that sequence is circular
           -direct           => boolean to directly set sequences. The next time -seq,
                                seq() or -ref_to_seq is use, the sequence will not be
                                validated. Be careful with this...
           -nowarnonempty    => boolean to avoid warning when sequence is empty

seq

 Title   : seq
 Usage   : $string = $seqobj->seq();
 Function: Get or set  the sequence as a string of letters. The case of
           the letters is left up to the implementer. Suggested cases are
           upper case for proteins and lower case for DNA sequence (IUPAC
           standard), but you should not rely on this. An error is thrown if
           the sequence contains invalid characters: see validate_seq().
 Returns : A scalar
 Args    : - Optional new sequence value (a string) to set
           - Optional alphabet (it is guessed by default)

validate_seq

 Title   : validate_seq
 Usage   : if(! $seqobj->validate_seq($seq_str) ) {
                print "sequence $seq_str is not valid for an object of
                alphabet ",$seqobj->alphabet, "\n";
           }
 Function: Test that the given sequence is valid, i.e. contains only valid
           characters. The allowed characters are all letters (A-Z) and '-','.',
           '*','?','=' and '~'. Spaces are not valid. Note that this
           implementation does not take alphabet() into account and that empty
           sequences are considered valid.
 Returns : 1 if the supplied sequence string is valid, 0 otherwise.
 Args    : - Sequence string to be validated
           - Boolean to optionally throw an error if the sequence is invalid

subseq

 Title   : subseq
 Usage   : $substring = $seqobj->subseq(10,40);
           $substring = $seqobj->subseq(10,40,'nogap');
           $substring = $seqobj->subseq(-start=>10, -end=>40, -replace_with=>'tga');
           $substring = $seqobj->subseq($location_obj);
           $substring = $seqobj->subseq($location_obj, -nogap => 1);
 Function: Return the subseq from start to end, where the first sequence
           character has coordinate 1 number is inclusive, ie 1-2 are the
           first two characters of the sequence. The given start coordinate
           has to be larger than the end, even if the sequence is circular.
 Returns : a string
 Args    : integer for start position
           integer for end position
                 OR
           Bio::LocationI location for subseq (strand honored)
           Specify -NOGAP=>1 to return subseq with gap characters removed
           Specify -REPLACE_WITH=>$new_subseq to replace the subseq returned
           with $new_subseq in the sequence object

length

 Title   : length
 Usage   : $len = $seqobj->length();
 Function: Get the stored length of the sequence in number of symbols (bases
           or amino acids). In some circumstances, you can also set this attribute:
           1. For empty sequences, you can set the length to anything you want:
              my $seqobj = Bio::PrimarySeq->new( -length => 123 );
              my $len = $seqobj->len; # 123
           2. To save memory when using very long sequences, you can set the
              length of the sequence to the length of the sequence (and nothing
              else):
              my $seqobj = Bio::PrimarySeq->new( -seq => 'ACGT...' ); # 1 Mbp sequence
              # process $seqobj... then after you're done with it
              $seqobj->length($seqobj->length);
              $seqobj->seq(undef); # free memory!
              my $len = $seqobj->len; # 1 Mbp
           Note that if you set seq() to a value other than undef at any time,
           the length attribute will be reset.
 Returns : integer representing the length of the sequence.
 Args    : Optionally, the value on set

display_id

 Title   : display_id or display_name
 Usage   : $id_string = $seqobj->display_id();
 Function: Get or set the display id, aka the common name of the sequence object.
           The semantics of this is that it is the most likely string to
           be used as an identifier of the sequence, and likely to have
           "human" readability.  The id is equivalent to the ID field of
           the GenBank/EMBL databanks and the id field of the
           Swissprot/sptrembl database. In fasta format, the >(\S+) is
           presumed to be the id, though some people overload the id to
           embed other information. Bioperl does not use any embedded
           information in the ID field, and people are encouraged to use
           other mechanisms (accession field for example, or extending
           the sequence object) to solve this.
           With the new Bio::DescribeableI interface, display_name aliases
           to this method.
 Returns : A string for the display ID
 Args    : Optional string for the display ID to set

accession_number

 Title   : accession_number or object_id
 Usage   : $unique_key = $seqobj->accession_number;
 Function: Returns the unique biological id for a sequence, commonly
           called the accession_number. For sequences from established
           databases, the implementors should try to use the correct
           accession number. Notice that primary_id() provides the
           unique id for the implementation, allowing multiple objects
           to have the same accession number in a particular implementation.
           For sequences with no accession number, this method should
           return "unknown".
           [Note this method name is likely to change in 1.3]
           With the new Bio::IdentifiableI interface, this is aliased
           to object_id
 Returns : A string
 Args    : A string (optional) for setting

primary_id

 Title   : primary_id
 Usage   : $unique_key = $seqobj->primary_id;
 Function: Returns the unique id for this object in this
           implementation. This allows implementations to manage their
           own object ids in a way the implementation can control
           clients can expect one id to map to one object.
           For sequences with no natural primary id, this method
           should return a stringified memory location.
 Returns : A string
 Args    : A string (optional, for setting)

alphabet

 Title   : alphabet
 Usage   : if( $seqobj->alphabet eq 'dna' ) { # Do something }
 Function: Get/set the alphabet of sequence, one of
           'dna', 'rna' or 'protein'. This is case sensitive.
           This is not called <type> because this would cause
           upgrade problems from the 0.5 and earlier Seq objects.
 Returns : a string either 'dna','rna','protein'. NB - the object must
           make a call of the type - if there is no alphabet specified it
           has to guess.
 Args    : optional string to set : 'dna' | 'rna' | 'protein'

desc

 Title   : desc or description
 Usage   : $seqobj->desc($newval);
 Function: Get/set description of the sequence.
           'description' is an alias for this for compliance with the
           Bio::DescribeableI interface.
 Returns : value of desc (a string)
 Args    : newvalue (a string or undef, optional)

can_call_new

 Title   : can_call_new
 Usage   :
 Function:
 Example :
 Returns : true
 Args    :

id

 Title   : id
 Usage   : $id = $seqobj->id();
 Function: This is mapped on display_id
 Example :
 Returns :
 Args    :

is_circular

 Title   : is_circular
 Usage   : if( $seqobj->is_circular) { # Do something }
 Function: Returns true if the molecule is circular
 Returns : Boolean value
 Args    : none

Methods for Bio::IdentifiableI compliance

object_id

 Title   : object_id
 Usage   : $string = $seqobj->object_id();
 Function: Get or set a string which represents the stable primary identifier
           in this namespace of this object. For DNA sequences this
           is its accession_number, similarly for protein sequences.
           This is aliased to accession_number().
 Returns : A scalar
 Args    : Optional object ID to set.

version

 Title   : version
 Usage   : $version = $seqobj->version();
 Function: Get or set a number which differentiates between versions of
           the same object. Higher numbers are considered to be
           later and more relevant, but a single object described
           the same identifier should represent the same concept.
 Returns : A number
 Args    : Optional version to set.

authority

 Title   : authority
 Usage   : $authority = $seqobj->authority();
 Function: Get or set a string which represents the organisation which
           granted the namespace, written as the DNS name of the
           organisation (eg, wormbase.org).
 Returns : A scalar
 Args    : Optional authority to set.

namespace

 Title   : namespace
 Usage   : $string = $seqobj->namespace();
 Function: Get or set a string representing the name space this identifier
           is valid in, often the database name or the name describing the
           collection.
 Returns : A scalar
 Args    : Optional namespace to set.

Methods for Bio::DescribableI compliance

This comprises of display_name and description.

display_name

 Title   : display_name
 Usage   : $string = $seqobj->display_name();
 Function: Get or set a string which is what should be displayed to the user.
           The string should have no spaces (ideally, though a cautious
           user of this interface would not assume this) and should be
           less than thirty characters (though again, double checking
           this is a good idea).
           This is aliased to display_id().
 Returns : A string for the display name
 Args    : Optional string for the display name to set.

description

 Title   : description
 Usage   : $string = $seqobj->description();
 Function: Get or set a text string suitable for displaying to the user a
           description. This string is likely to have spaces, but
           should not have any newlines or formatting - just plain
           text. The string should not be greater than 255 characters
           and clients can feel justified at truncating strings at 255
           characters for the purposes of display.
           This is aliased to desc().
 Returns : A string for the description
 Args    : Optional string for the description to set.

Methods Inherited from Bio::PrimarySeqI

These methods are available on Bio::PrimarySeq, although they are actually implemented on Bio::PrimarySeqI

revcom

 Title   : revcom
 Usage   : $rev = $seqobj->revcom();
 Function: Produces a new Bio::SeqI implementing object which
           is the reversed complement of the sequence. For protein
           sequences this throws an exception of
           "Sequence is a protein. Cannot revcom".
           The id is the same id as the original sequence, and the
           accession number is also identical. If someone wants to
           track that this sequence has be reversed, it needs to
           define its own extensions.
           To do an inplace edit of an object you can go:
           $seqobj = $seqobj->revcom();
           This of course, causes Perl to handle the garbage
           collection of the old object, but it is roughly speaking as
           efficient as an inplace edit.
 Returns : A new (fresh) Bio::SeqI object
 Args    : none

trunc

 Title   : trunc
 Usage   : $subseq = $myseq->trunc(10,100);
 Function: Provides a truncation of a sequence,
 Returns : A fresh Bio::SeqI implementing object.
 Args    : Numbers for the start and end positions

Internal methods

These are internal methods to PrimarySeq

_guess_alphabet

 Title   : _guess_alphabet
 Usage   :
 Function: Automatically guess and set the type of sequence: dna, rna, protein
           or '' if the sequence was empty. This method first removes dots (.),
           dashes (-) and question marks (?) before guessing the alphabet
           using the IUPAC conventions for ambiguous residues. Since the DNA and
           RNA characters are also valid characters for proteins, there is
           no foolproof way of determining the right alphabet. This is our best
           guess only!
 Returns : string 'dna', 'rna', 'protein' or ''.
 Args    : none

History